The applications listed here are available for use in the Discovery Environment and are documented in: Discovery Environment Manual.

Discovery Environment Applications List

The box below searches only this space.
To search the entire iPlant wiki, enter your query in the box at the upper right.

 

 

 

 

 

Skip to end of metadata
Go to start of metadata

FASTX Clippercc0.0.14

FASTX Clipper is used for removing sequencing adapters and linkers.

Quick Start

Test Data

All files are located in the Community Data directory of the CyVerse Discovery Environment at the following path:

Community Data > iplantcollaborative > example_data > fastx_clipper

Input File(s)

Use Barcoded.fq as test data.

Parameters Used in App

When the app is run in the Discovery Environment, use the following parameters with the above input file(s) to get the output provided in the next section below.

  • Use these parameters within the DE app interface:
    • Enter the adapter string to clip - CTGTAGGCACCATCAATCGTATGCCGTCTTCTGCTTG
    • Leave other parameters in the default states

Output File(s)

Expect a FASTQ file fastx_clipper_out.fastq as output.

Tool Source for App

3 Comments

  1. ★★★★☆ null (by sanjeevsingh)

  2. ★★★★★ null (by emirislamovic)

  3. ☆☆☆☆☆ null (by reddy)