Versions Compared

Key

  • This line was added.
  • This line was removed.
  • Formatting was changed.

FASTX

...

Clippercc0.0.14

FASTX Clipper is used for removing sequencing adapters and linkers.

Quick Start

Test Data

All files are located in the Community Data directory of the

...

CyVerse Discovery Environment at the following path:

Community Data > iplantcollaborative > example_data > fastx_clipper

Input File(s)

Use Barcoded.fq as test data.

Parameters Used in App

When the app is run in the Discovery Environment, use the following parameters with the above input file(s) to get the output provided in the next section below.

  • Use these parameters within the DE app interface:
    • Enter the adapter string to clip - CTGTAGGCACCATCAATCGTATGCCGTCTTCTGCTTG
    • Leave other parameters in the default states

Output File(s)

Expect a FASTQ file 'fastx_clipper_out.fastq' as output.

Tool Source for App