This box searches only this space. The box at the upper right searches the entire iPlant wiki.

Versions Compared

Key

  • This line was added.
  • This line was removed.
  • Formatting was changed.

...

https://docs.google.com/presentation/d/1JEvYqTRk9SJbwhIcsrwjVSi1XVOJyad2nsBxN3jne4A/edit?usp=sharing


Midterm Demo:

Human GAPDH sequence:

 

>NR_152150.2 Homo sapiens glyceraldehyde-3-phosphate dehydrogenase (GAPDH), transcript variant 6, non-coding RNA
GCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGCCACATCGCTCA
GACACCATGGGGAAGGTGAAGGTCGGAGTCAACGGATTTGGTCGTATTGGGCGCCTGGTCACCAGGGCTG
CTTTTAACTCTGGTAAAGTGGATATTGTTGCCATCAATGACCCCTTCATTGACCTCAACTACATGGTTTA
CATGTTCCAATATGATTCCACCCATGGCAAATTCCATGGCACCGTCAAGGCTGAGAACGGGAAGCTTGTC
ATCAATGGAAATCCCATCACCATCTTCCAGGAGCGAGATCCCTCCAAAATCAAGTGGGGCGATGCTGGCG
CTGAGTACGTCGTGGAGTCCACTGGCGTCTTCACCACCATGGAGAAGGCTGGGGCTCATTTGCAGGGGGG
AGCCAAAAGGGTCATCATCTCTGCCCCCTCTGCTGATGCCCCCATGTTCGTCATGGGTGTGAACCATGAG
AAGTATGACAACGAATTTGGCTACAGCAACAGGGTGGTGGACCTCATGGCCCACATGGCCTCCAAGGAGT
AAGACCCCTGGACCACCAGCCCCAGCAAGAGCACAAGAGGAAGAGAGAGACCCTCACTGCTGGGGAGTCC
CTGCCACACTCAGTCCCCCACCACACTGAATCTCCCCTCCTCACAGTTGCCATGTAGACCCCTTGAAGAG
GGGAGGGGCCTAGGGAGCCGCACCTTGTCATGTACCATCAATAAAGTACCCTGTGCTCAACCA

 

Random DNA generator:

https://faculty.ucr.edu/~mmaduro/random.htm